Nucleotide sequence of wheat chloroplastid 4.5 S ribonucleic acid. Sequence homologies in 4.5 S RNA species.

نویسندگان

  • A G Wildeman
  • R N Nazar
چکیده

The nucleotide sequence of wheat (Triticum aestivum L.) chloroplastid ribosome-associated 4.5 S RNA is U-A-A-G-G-U-G-A-G-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-A-A-U-A-G-G-U-G-U-C-A-A -G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-A-G-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C- G-A-A-C-G-A-A-C-G-A-U-U-U-G-A-A-COH. The sequence is highly conserved among chloroplastid 4.5 S RNAs but not related to either the 5 S or 5.8 S rRNA species. When compared with 4.5 S RNAs from other origins, the results indicate that this molecule bears little sequence homology to the mammalian nuclear 4.5 S RNA but suggest that chloroplastid 4.5 S RNA may be related to the bacerial 4.5 S species. An estimate for the secondary structure of the wheat 4.5 S molecule was deduced from products of limited pancreatic and T1 ribonuclease digestion, and similarities with the Escherichia coli 4.5 S RNA are discussed.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Nucleotide Sequence and Secondary Structure Analysis

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be H~AGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGAC WGAACoH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5’-end not found in other chloroplast 4.5 S RNAs and a seven-nucle...

متن کامل

Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it c...

متن کامل

Nucleotide sequence homology to pertussis toxin gene in Bordetella bronchiseptica and Bordetella parapertussis.

Multiple strains of Bordetella parapertussis and B. bronchiseptica were examined for the presence of nucleotide sequences which hybridized with a cloned 4.5-kilobase (kb) fragment of B. pertussis DNA containing the genes responsible for pertussis toxin expression. All six B. parapertussis strains tested had nucleic acid sequences that hybridized with the cloned 4.5-kb fragment in Southern blot ...

متن کامل

Nucleotide sequence of Thermus aquaticus ribosomal 5 S ribonucleic acid. Sequence homologies in thermophilic organisms.

The nucleotide sequence of ribosomal 5 S RNA from Thermus aquaticus grown at 75 degrees is p(A)-A-U-C-C-C-C-G-C-C-C-U-U-A-G-C-G-G-C-G-U-G-G-A-A-C-A-C-C-C-G-U-U-C-C-C-A-U-U-C-C-G-A-A-C-A-C-G-G-A-A-G-U-G-A-A-A-C-G-C-G-C-C-A-G-C-G-C-C-G-A-U-G-G-U-C-A-C-U-G-G-G-A-C-C-G-C-A-G-G-G-U-C-C-U-G-G-A-G-A-G-U-A-G-G-U-G-C-U-G-G-U-G-C-G-G-G-G-A-(U). The major molecular species is 120 nucleotides long; some mo...

متن کامل

Printed in Great Britain 4 . 5 S Ribonucleic Acid , a Novel Ribosome Component in the Chloroplasts of Flowering Plants

A species of low-molecular-weight ribosomal RNA, referred to as '4.5 S rRNA', was found in addition to 5 S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the br...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • The Journal of biological chemistry

دوره 255 24  شماره 

صفحات  -

تاریخ انتشار 1980